Primer M13 Sequence. In order to enable fast and convenient ordering of sequencing primers that are widely used to.
High resolution close to the sequencing primer xx – xx (if using POP6™) M13 tailed PCR.
(PDF) An alternate universal forward primer for improved
PDF fileSequencing Primers Sequencing PrimersPrimer Sequence Cat# T m (°C)* Applicable Vectors RNA Polymerase Promoter Primers SP6 5′d(TATTTAGGTGACACTATAG)3′ Q5011 42 pGEM pUC/M13 Primers Forward (17mer) (–40) 5′d(GTTTTCCCAGTCACGAC)3′ Q5391 50 pGEM.
Resources Primers Standard Primers DNA Sequencing
primer sequence (5’3′) m1321 tgt aaa acg acg gcc agt m1347 cgc cag ggt ttt ccc agt cac gac m13rev4 tca cac agg aaa cag cta tga c t7 taa tac gac tca cta tag gg t7term gct agt tat tgc tca gcg g t3 att aac cct cac taa agg ga pcriit7 cga ctc act ata ggg cga att ggg pcriisp6 ggt gac act ata gaa tac tca agc sp6 gat tta ggt gac act ata g poly tg (t) 25 g poly tc (t) 25 c poly ta.
Primer Sequences – HSC Cores: Home
PDF fileSequences of the Primers The table below provides the sequences of the M13 Forward (20) and M13 Reverse sequencing primersPrimer Sequence pMoles Supplied M13 Forward (20) 5´GTAAAACGACGGCCAG3´ 407 M13 Reverse 5´CAGGAAACAGCTATGAC3´.
Primer Design Tutorial Geneious Prime
– SignaGen Blog Commonly Used Primers
DNA Sequencing Primer Sequences
Standard Primers
Preparing SMRTbell Libraries Using PacBio Barcoded M13
M13 Forward (20)
SigmaAldrich primer set (−21) M13 Forward
Promega Sequencing Primers
Common primer sequences OpenWetWare
Sequencing Reaction for Sanger Sequencing Thermo Fisher
Why use M13F tailed primers for PCR and sequencing? …
What is M13 primer sequence? – Raiseupwa.com
pENTR™ Directional TOPO® Cloning Kits
Primer M13/pUC Reverse Sequencing
Addgene: Sequencing Primers
pGEMT Sequencing Primers Cornell College
Universal Primer List Genetic Sequencing
PDF fileM13RP and M13 rev (29) (same sequence) M13rev49 GAGCGGATAACAATTTCACACAGG M13 rev (49) (same sequence) M13uni21 TGTAAAACGACGGCCAGT M13FP and M13 uni (21) (same sequence) M13uni43 AGGGTTTTCCCAGTCACGACGTT M13 uni (43) (same sequence) pBABE3 ACCCTAACTGACACACATTCC pBABE5 CTTTATCCAGCCCTCAC pBADFP.